pegfp c1 backbone (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
86
Structured Review
TaKaRa
pegfp c1 backbone
Pegfp C1 Backbone, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+backbone/pm39048751-330-11-13
Average 86 stars, based on 1 article reviews
Pegfp C1 Backbone, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+c1+backbone/pm39048751-330-11-13
Average 86 stars, based on 1 article reviews
pegfp c1 backbone - by Bioz Stars,
2026-11
86/100 stars
Images
Related Articles
other:Article Title: A Trio-Rac1-PAK1 signaling axis drives invadopodia disassembly Article Snippet: Human siRNA smart pools for Rac1 (L-003560), Trio (L-005047), PAK1 (L-003521) were purchased from Dharmacon. Article Title: BCL-2 and BOK regulate apoptosis by interaction of their C-terminal transmembrane domains. Article Snippet: Generation of vectors for transgene expression Plasmids encoding for NanoBiT TMD fusion proteins were cloned using the NEBuilder system (New England Biolabs, Ipswich, MA, USA). Amplification:Article Title: Integrated single-cell multiomics analysis reveals novel candidate markers for prognosis in human pancreatic ductal adenocarcinoma Article Snippet: We extracted the total RNA from the pancreas tissue using the QIAGEN RNeasy kit according to the manufacturer’s instructions. .. ZNF667-AS1 was amplified by RT-PCR (forward primer: CCCTCGAGCGGTGTTGCGCCTGCGTAGCCG; reverse primer: GGAATTCGTCATGAGAAGGTGATTTATTGGAAAGT), and then Xho I (NEB, R0416) and Eco RI (NEB, R0101) were used to clone the cDNA fragments into the Article Title: Single-molecule analysis of steroid receptor and cofactor action in living cells Article Snippet: .. It has been generated by PCR amplification from pcDNA3-FLAG-Fos WT and sub cloned into the Reverse Transcription Polymerase Chain Reaction:Article Title: Integrated single-cell multiomics analysis reveals novel candidate markers for prognosis in human pancreatic ductal adenocarcinoma Article Snippet: We extracted the total RNA from the pancreas tissue using the QIAGEN RNeasy kit according to the manufacturer’s instructions. .. ZNF667-AS1 was amplified by RT-PCR (forward primer: CCCTCGAGCGGTGTTGCGCCTGCGTAGCCG; reverse primer: GGAATTCGTCATGAGAAGGTGATTTATTGGAAAGT), and then Xho I (NEB, R0416) and Eco RI (NEB, R0101) were used to clone the cDNA fragments into the Plasmid Preparation:Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR ampli ed from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283437) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR ampli ed from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2AmCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213928) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated Page 14/30 using the Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #72834 ) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139 ) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated using the Expressing:Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR ampli ed from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283437) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR ampli ed from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2AmCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213928) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated Page 14/30 using the Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #72834 ) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139 ) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated using the Generated:Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR ampli ed from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283437) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR ampli ed from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2AmCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213928) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated Page 14/30 using the Article Title: Single-molecule analysis of steroid receptor and cofactor action in living cells Article Snippet: .. It has been generated by PCR amplification from pcDNA3-FLAG-Fos WT and sub cloned into the Article Title: Regulation of the endosomal SNX27-retromer by OTULIN Article Snippet: Isolated cells were cultured in primary T cell medium (RPMI medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1% NEAA, 1% HEPES, 1% l -glutamine, 1% sodium pyruvate and 0.1% β-mercaptoethanol) and pre-stimulated with plate-bound anti-CD3/28 antibodies (BD Pharmingen), for 48 h. For cell expansion recombinant IL-2 (1:5000) was added to the medium. .. DNA constructs for this study were generated by common molecular biological techniques using TOP10 or Stbl3 Chemically Competent E. Coli . cDNAs were cloned into a modified pEF4 (Thermo Scientific), a modified pcDNA3.1 or the Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #72834 ) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139 ) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated using the Derivative Assay:Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR ampli ed from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283437) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR ampli ed from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2AmCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213928) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated Page 14/30 using the Article Title: A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis Article Snippet: To construct pAAVS1-ROLECCS AS, pAAVS1-ROLECCS G1, and pAAVS1-ROLECCS G2 plasmids, multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #72834 ) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139 ) was used as template for both hGeminin and hCdt1 tags. .. The vector for the mAID-mCherry expression was generated using the Polymerase Chain Reaction:Article Title: Single-molecule analysis of steroid receptor and cofactor action in living cells Article Snippet: .. It has been generated by PCR amplification from pcDNA3-FLAG-Fos WT and sub cloned into the Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Clone Assay:Article Title: Single-molecule analysis of steroid receptor and cofactor action in living cells Article Snippet: .. It has been generated by PCR amplification from pcDNA3-FLAG-Fos WT and sub cloned into the Article Title: Regulation of the endosomal SNX27-retromer by OTULIN Article Snippet: Isolated cells were cultured in primary T cell medium (RPMI medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1% NEAA, 1% HEPES, 1% l -glutamine, 1% sodium pyruvate and 0.1% β-mercaptoethanol) and pre-stimulated with plate-bound anti-CD3/28 antibodies (BD Pharmingen), for 48 h. For cell expansion recombinant IL-2 (1:5000) was added to the medium. .. DNA constructs for this study were generated by common molecular biological techniques using TOP10 or Stbl3 Chemically Competent E. Coli . cDNAs were cloned into a modified pEF4 (Thermo Scientific), a modified pcDNA3.1 or the Construct:Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Article Title: Regulation of the endosomal SNX27-retromer by OTULIN Article Snippet: Isolated cells were cultured in primary T cell medium (RPMI medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1% NEAA, 1% HEPES, 1% l -glutamine, 1% sodium pyruvate and 0.1% β-mercaptoethanol) and pre-stimulated with plate-bound anti-CD3/28 antibodies (BD Pharmingen), for 48 h. For cell expansion recombinant IL-2 (1:5000) was added to the medium. .. DNA constructs for this study were generated by common molecular biological techniques using TOP10 or Stbl3 Chemically Competent E. Coli . cDNAs were cloned into a modified pEF4 (Thermo Scientific), a modified pcDNA3.1 or the Ligation:Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Luciferase:Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Sequencing:Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Modification:Article Title: A high-content screen reveals new regulators of nuclear membrane stability Article Snippet: HeLa cells were arrested in S phase by a single addition of 2 mM hydroxyurea (EMD Millipore) diluted in water. .. 1× and 2× RFP-luciferase constructs were made in Article Title: Regulation of the endosomal SNX27-retromer by OTULIN Article Snippet: Isolated cells were cultured in primary T cell medium (RPMI medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1% NEAA, 1% HEPES, 1% l -glutamine, 1% sodium pyruvate and 0.1% β-mercaptoethanol) and pre-stimulated with plate-bound anti-CD3/28 antibodies (BD Pharmingen), for 48 h. For cell expansion recombinant IL-2 (1:5000) was added to the medium. .. DNA constructs for this study were generated by common molecular biological techniques using TOP10 or Stbl3 Chemically Competent E. Coli . cDNAs were cloned into a modified pEF4 (Thermo Scientific), a modified pcDNA3.1 or the |
